Thread: please help with out of bounds exception

so I have a task for an online course (in which the forums are no longer active) where i have to find the ratio of letters (C and G) in a string.
I've marked where i'm getting an out of bounds error -1 with ***
although i'm stuck as to why

pls help

p.s. the error is all i need help with at the moment, I would prefer to figure the rest out on my own :)

public String cgRatio (String dna){
int currIndex = 0;
float cCount = 0;
float gCount = 0;
int startIndex = 0;
while (true){
currIndex = dna.indexOf(startIndex);
if ( dna.substring(currIndex, currIndex +1) == "C"){ ***
cCount ++;
}
if (dna.substring(currIndex, currIndex +1) == "G"){
gCount ++;
}
if (currIndex >= dna.length()){
break;
}
startIndex = currIndex +1;
}
return "c to g ratio is " + (cCount/gCount);
}


//being called to:
public void test(){
cgRatio ("CCATGCCCCTATAGTAGATGTTAAAAGAAATATGAACTTAGATTAAGA AACCCC"); ***
cgRatio ("");
cgRatio ("ATGTATAGATATAAATATAGAGSsaegTGATAGoiajhegoijaTGA" );
}

The exception you are getting is a StringIndexOutOfBoundsException which can occur when no such character is in bounds of a string. The problem you had is that with dna.indexOf(startIndex), you are looking for a character that has a value of 0, not updating the current index.